Human Variation and Race

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress negatively impacts the survival of humans by disturbing homeostasis.

One environmental stress that negatively impacts the survival of humans is high levels of solar radiation. How so? Overexposure to UV radiation often causes genetic mutations with consideration to skin cells. According to the authors of Introduction to Physical Anthropology, “These mutations can lead to skin cancer, which, if left untreated, can eventually spread to other organs and even cause death” (Jurmain et al. 415). To avoid this disturbance in homeostasis, melanin, a substance produced by melanocytes, absorbs threatening ultraviolet rays. 

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural). Include images of the adaptations.

A short-term adaptation to a stress has much to do with an organism’s response to an environmental change in effort to maintain homeostasis. With high levels of solar radiation in mind, there is no short-term adaptation.

A facultative adaptation, on the other hand, requires an alteration of a phenotypic expression in response to the stress. A facultative adaptation to high levels of solar radiation is tanning. As discussed earlier melanin is essential in dodging dangerous UV rays. How do we acquire the production of melanin? Tanning, a form of acclimatization, provides a temporary increase in melanin production. The authors state that “most forms of acclimatization are temporary and last only until environmental conditions return to their former state” (Jurmain et al. 414). The act of tanning to produce melanin can be achieved by the majority of humans except for albinos. Albinos are unable to produce melanin because a genetic mutation prevents their melanocytes from doing so.

Developmental adaptations have to do with changes in DNA of a population, resulting in a phenotypic change brought on evolutionary forces. A developmental adaptation of high levels of solar radiation is dark skin. When discussing high levels of solar radiation, it is important to make note of folate, a B vitamin that must be replenished through diet. Unfortunately, ultraviolet radiation has been known to diminish folate levels in light skinned people. As a result, the authors mention the fact that “dark skin evolved rather rapidly as a protective response to the damaging effects of UV radiation on folate” (Jurmain et al. 417). 

Lastly, cultural adaptations are those in which humans use some form of culture to adapt to the stress, whether it be a clothing style or a tool. In this case, the use of animal skins in addition to sunblock provides a cultural adaption. Those who migrated into Asia and Europe wore animal skins or other types of clothing to protect themselves from the rays of the sun. Nowadays, UV protective clothing is available to purchase. Also, sunblock is often used to avoid a sunburn. Sunscreen bottles provide essential information such as SPF, or sun protection factor, which indicates how well the sunscreen protects an individual from burning ultraviolet rays (UVB).

3. What are the benefits of studying human variation from this perspective across environmental clines? Can information from explorations like this be useful to help us in any way? Offer one example of how this information can be used in a productive way. 

There is great benefit from examining human variation across environmental clines. By examining human variation in any given environment, we become aware of various conditions that may pose a threat. For instance, UV radiation is the most common cause of skin cancer. From an evolutionary perspective, we are reminded that early hominins lived in the tropical areas, spent most of their time outdoors, and did not wear protective clothing (Jurmain et al. 416). With this in mind, studies have indicated that these hominins, especially those with less pigmented skin, experienced lessened reproductive fitness. Also, we know that humans of northern European descent produce small amounts of melanin while those in the tropics remain deeply pigmented. By placing an individual with a specific set of traits in a new environment, new evidence arises.  

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race.

The use of race to understand the variation of adaptations is unnecessary.  The study of environmental influences on adaptations proves to be most effective. In this case, we examine skin color, a trait controlled by the production of melanin, across the environmental stress of solar radiation. Skin color serves as an adaptation through natural selection. The ways in which humans can successfully reproduce have to do with the adaptations previously mentioned. The tropics contain those with the most pigmentation while the northern latitudes hold individuals with lighter skin. As soon as individuals with dark skin migrated to the northern latitudes, the need for vitamin B immensely grew. Overall, we are enlightened on human variation by studying the expression of traits.

Citations

Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. Introduction to Physical Anthropology. Belmont, CA: Wadsworth Cengage Learning, 2014. Print.

Language

For this assignment, I was asked to engage in a conversation for 15 minutes. The challenging part of the conversation was not being allowed to take part in any version of symbolic language, such as speaking, writing, or American Sign Language. In doing so, I asked my boyfriend and a good friend of mine to take part in the conversation. Because my boyfriend became frustrated with the difficulty this challenge presented, I will be focusing on the interaction between my good friend and myself. My friend, Scythia, and I decided to go shopping one day, where I explained what we would be doing for this so-called experiment. After she agreed to converse, we chose a table to sit down at so that she may have a better time understanding myself. During the fifteen minutes, we covered the following topics: shopping, hunger, and work. I attempted to explain to her that because of all the shopping, I had become very hungry. I did this by a combination of hand gestures and facial expressions. I placed my hand over my stomach and made a face resembling that of desperation. Scythia was quick to acknowledge my hunger, but had a hard time understanding what I had wanted to eat. I tried explaining that I felt like having a tuna sandwich; therefore, I made a fish face. After much debate, we moved onto the topic of work. I explained to her that I was not looking forward to working (in a grocery store) on St. Patrick’s Day because of all the party goers who come in late at night. Surprisingly, she understood my concerns because we share the same background when it comes to work. Overall, this conversation was difficult to say the least. She explained that she felt as though she was initiating most of the conversation. Throughout the process, she altered her way of communicating by changing the type of questions asked. What I mean is that these questions required a simple yes or no, accomplished by a head movement.

Because I had difficulty getting my points across, Scythia was in control of the conversation. At times, she became frustrated because she could not grasp any ideas presented. As previously mentioned, she directed the conversation elsewhere when she really had no idea what I was saying. As far as asking her questions, I could easily ask her if she was hungry while on the topic. But, there was struggle in deciding what to eat. To choose something to eat, she would randomly say a list of foods, in which I would then nod yes or no. Therefore, the bulk of asking came from her side. If I had conducted this experiment with a group of people, I feel as though I would be excluded in some way. When considering the conversation as a balance of power, Scythia had the power. Scythia retained power throughout the conversation because she initiated or changed topics.

If Scythia and I represented two different cultures, one that uses spoken language and one that does not, her culture would have an advantage. The culture that uses spoken language definitely has the advantage in communicating complex ideas within their population. Not only can her population understand the concepts presented, but do so in a quick manner. It took fifteen minutes for her and myself to discuss a few topics; whereas it would take five minutes if we were to both speak. In addition,  the speaking culture may have a certain attitude toward the culture that does not use symbolic language. For instance, the speaking culture may express superiority while engaging because they assume control over the conversation. Not only would they feel superior, but frustrated at a lack of comprehension. If not experiencing superiority or frustration, then confusion may arise. In relation to modern times, I am faced with interacting with all sorts of people, some of which from different countries. At first, I feel as though I am being ignored when getting no initial response. As soon as I become aware that this person does not speak English, being able to effectively meet their needs becomes the main problem. 

For the second part of the assignment, I was asked to engage in conversation for fifteen minutes without any physical embellishments. When I had first explained what we would be doing to Scythia, she laughed. Everyone who knows me can testify that I am a facially expressive person. My coworkers describe myself as a human emoji. You will always know what I am feeling because my face says it all. With this in mind, I knew that this set of rules would be challenging to follow. The following topics were discussed: living situations and a confrontation at Scythia’s work. Scythia began the conversation by claiming that her living situation often time feels unbearable due to having a roommate. She explained using instances, where I would then slip a smirk or slight raise of the brows. Anytime that I did slip, she would yell at me to stop. Each time she yelled at me, I had to focus on being monotone. I found this section equally challenging because I felt as though I came across uninterested in what she was saying. Most of the time I felt bad because I could not show any enthusiasm or empathy for any content being discussed. My partner’s response to the lack of body language can be described as grateful, for this temporary. She claimed that she did not care for the fact that I was monotone and was glad it was over. Overall, she could understand what I was saying; however, felt a lack of enthusiasm.

This experiment highlights the importance of “signs” in our language. Non-speech language techniques include gestures, body position, and eye contact.  For instance, an effective public speaker may use hand gestures during his or her speech to ease comprehension. We also see use of hand gestures in everyday conversation with others, such as a wave hello or good-bye. Speakers tend to use their hands to get their point across. Much information can be taken from a person’s body language. For instance, someone applying for a position may enthusiastically say anything that would make them appealing. But, their body position may tell a different story. Take a person who just experienced a break up for an example of eye contact. A woman may force a smile and tell her friends that she is alright, while she appears to be crying at the same time. All of the clues brought forth by body language can tell you a lot about how a person is actually feeling. Interpersonal relationships can grow with knowing how a person is actually feeling.

There is great benefit to reading body language when it comes to survival, obtaining resources, and reproducing successfully. As far as survival goes, a person can become aware of danger that may arise based on the body language of another. For instance, a police officer examines an individual's body language for clues pertaining to danger. When a person is pulled over, his or her hands should be place on the wheel to avoid suspicious behavior. If someone were to come off aggressive by the clenching of fists, then one should stay away.  Babies use their body language to obtain resources from their mother. A simple hand gesture or movement of the lips indicate that it is feeding time. Also, by reading body language, you can tell if another person finds you attractive. For instance, your date may not be saying all of the right things, but remaining close to your side with the touch of a hand will say otherwise.

There are many people that have difficulty reading body language. Some conditions that affect the ability to read body language include Asperger's Syndrome or Borderline Personality Disorder. Due to the inability to read body language, people with Asperger's will experience difficulty when interacting with others. Although they express interest in the idea of making friends, their insensitivity to other's feelings and expressions makes it increasingly difficult. Individuals with Borderline Personality Disorder, on the other hand, lack the ability to interpret facial expressions. Expressions are usually interpreted in a negative manner, making it difficult to create relationships. A situation in which body language does not provide reliable information can be found within the interaction of different cultures. For example, my father married a Filipino woman when I was ten years old. At that time, I would describe myself as a picky eater, accustomed to eating the same foods each day. Whenever I stayed with my father, my stepmother would make dinner each night, which consisted of Filipino food. Based on my facial expressions, one would suggest that I did not care for Filipino food. In reality, I was not used to the new odor. However, I became quite fond of Filipino food as time went on. In this instance, my body language would not provide my stepmother with reliable information because I actually enjoyed her cooking.

Piltdown Hoax

The Piltdown hoax began in the early 1900s in Sussex, England. Near the village of Piltdown, a piece of a skull had been discovered by a laborer. The artifact had then been given to the archaeologist, Charles Dawson. Dawson claimed that the skull possessed features similar to those of a primate. The scientific significance of this finding has much to do with Darwin’s idea that living things descended from the same ancestor. During the time of the Origin of Species, evolution was deemed unorthodox in Great Britain. Therefore, obtaining a skull that appeared to be part human and part ape would have been a ground-breaking discovery in support of Darwin’s work. At the time, skeletal remains had been uncovered in Germany, France, and Spain. More so, Germany was thought of the birthplace of early man, which outraged Britain, for the British had no discoveries. In efforts to build both Britain’s and Dawson’s reputations, the Piltdown finding was worth pursuing. In doing so, Dawson and Woodward began digging, soon uncovering an ape-like jawbone with human-like teeth. This finding became known as the Piltdown Man.

The public was able to view the Piltdown Man on December 18^th, 1912. The British felt triumphant and prideful over the discovery. As far as the scientific community goes, scientists had their doubts whether the jawbone and skull matched. Unfortunately, parts had been broken off in a unique way so that there was no telling. With the addition of Chardin, a canine tooth was also found that would put an end to the doubtful thoughts. As time went on, the Piltdown Man was thought of as not genuine. The hoax began when Kenneth Oakley performed a chemical test so that the fossils could be authenticated. The results of the test had shown that the Piltdown Man was in fact young. Furthermore, by estimating nitrogen content, the skull appeared to be stained while the teeth had been filed down. In fact, the skull was not even of human nature. The scientific community as well as others were outraged. Suspects included Conan Doyle, Dawson, and Woodward.

A major human fault that comes into play when discussing the Piltdown Man has to do with a lack of evidence. Woodward failed to test the jaw for its nitrogen content. According to notes, this basic test would have easily proven the jaw to be very young. Not only did he fail to perform the nitrogen test, he did not analyze the filed teeth. This could have simply been done with a magnifying glass. The British appeared to be desperate in finding substantial support for Darwin’s evolutionary ideas so that they could triumph others.  Therefore, being overly prideful comes into play when discussing faults. These faults negatively impacted the scientific community by allowing people to believe in a hoax for forty or more years. As a result, they were embarrassed.

As previously discussed, scientists are able to chemically test the content of bones. Based on the skull’s nitrogen content, the authenticity and date of a bone can be revealed. In this case, the skull dates younger than actually predicted. Also, further speculations can be done in order to acquire information on any existing stain.

It is possible to remove the human factor from science now, given all of the advances. However, this does not mean that the human factor should be removed entirely from science. Science can still benefit from human input. For example, self- checkouts are added in grocery stores, partially eliminating the human factor. In reality, a human is still needed when the machines fail to function. As far as the Piltdown Man goes, human action  is what helped determine the hoax.

The life lesson taken from this historical event is to always double check findings for accuracy. The scientific process deals with testing a hypothesis over and over again so that it may one day become a theory.  Do not just assume something is valid because an unverified source claims it is, regardless of wanting to rise above.

Analogy and Homology

1. For your homologous traits provide the following information:

a. Briefly describe (not just identify) the two different species that possess the homologous trait.

According to Introduction to Physical Anthropology, “Structures that are shared by species on the basis of descent from a common ancestor are called homologies” (Jurmain et al. 110). What this means is that two species may share a homologous trait passed down from a common ancestor. The two different species that I chose to analyze for this assignment are horses and turtles. These species possess similarities having to do with the bones that makeup the forelimbs. A horse, a mammal, and a turtle, a reptile, both have forelimbs that consist of a humerus, radius, ulna, carpals, metacarpals, and phalanges.

b. Describe the homologous trait of each species, focusing on the differences in structure and

function of the trait. Why do these homologous traits exhibit differences between the two

species? Make sure your explanation is clear and complete.

As previously stated, one will find the same set of bones on the forelimbs of both horses and turtles. However, the forelimbs of these species vary in structure and function. The horse appears to have a more linear shape with regard to its bone structure. When observing its phalanges, a reduction from five digits to one digit can be seen. The reason for this is simply because the horse requires a strong, weigh bearing limb to support any type of locomotion. The turtle, on the other hand, appears to have metacarpals and phalanges that are more spread, somewhat resembling a human hand. The shape of a turtle's forelimb ensures propulsion through a rowing motion. The bones in the forelimbs exhibit differences between the two species in response to adaptation to locomotion.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait?

Generally, the horse is considered a mammal while the turtle is known as a reptile. The common ancestor of a mammal and a reptile can be thought of as an amphibian. Early amphibians are known to have forelimbs of similar structure and function.

d. Provide an image of each species in this comparison.

   

      

2. For your analogous traits provide the following information:

a. Briefly describe the two different species that possess the analogous trait.

Analogies are those similarities in which are based on common function, not taking common ancestry into consideration. Two different species that possess the analogous trait are birds and butterflies. These species both have wings; however, each set of wings has unique attributes. A bird's wings are attached to its shoulder girdle, located below its neck. The composition of a bird's wing consists of bone and muscle cells, covered by feathers. In comparison, a butterfly wing is made up of veins, encased by delicate scales (Understanding Evolution).

b. Describe the analogous trait of each species, focusing on the similarities in structure and

function of the trait. Clearly explain why these analogous traits exhibit similarities between

the two species.

When considering wings, a bird has bones while a butterfly lacks bones. Though there is a difference in composition, these wings serve a similar function. This analogous trait has allowed a bird and a butterfly to adapt to life in the air. Remarkably, these two different species have developed their wings independently. As a result, “…their (superficial) similarities are a product of separate evolutionary responses to roughly similar functional demands” (Jurmain et al. 110). For a better understanding, these similarities are brought forth by convergent evolution.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent?

Reptiles, ancestors of birds, do not have wings. An ancestor of butterflies, arthropods, appear to function without wings as well. Due to the fact that these ancestors appear to have no wings, one can conclude that this trait is analogous. These wings were developed as a means of living.

d. Provide an image of each species in this comparison.

 Citations

Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. Introduction to Physical Anthropology. Belmont, CA: Wadsworth Cengage Learning, 2014. Print.

Understanding Evolution. 2017. University of California Museum of Paleontology. 22 August 2008 <http://evolution.berkeley.edu/>.

Protein Synthesis

AGACTACCACGGCCCCAGTTCCAATCACGAGTTGTAAATCCAGA

Thomas Malthus' Influence on Darwin

1. An individual that has had a significant influence over the development of Darwin’s theory of Natural selection is Thomas Malthus. Malthus has positively impacted the works of Charles Darwin by writing an important essay.

2. Thomas Malthus, an English economist, contributed to the scientific community by writing An Essay on the Principle of Population in 1978. At the time, Malthus believed that human beings would struggle to prosper due to inadequate food supply. The reason for this shortfall in food supply would simply be due to overpopulation (WGBH Educational Foundation). In accomplishing sustainability, people would need to limit the number of children they had.  Before Darwin had read the essay in hopes of understanding the origin of species, he assumed that people had children well within their means. Afterward, he realized that overpopulation does in fact exist. According to the author, “…Darwin saw that the variation he had observed in wild populations would produce some individuals that were slightly better equipped to thrive and reproduce under the particular conditions at the same time” (WGBH Educational Foundation). Based on this observation, Darwin could piece together the fact that these stronger individuals would soon become dominant, resulting in the formation of a new species. In conclusion, the essay helped reveal that natural selection is the force that drives evolution.

3. The points most influenced by Malthus’ work have to do with the organisms having the potential to reproduce exponentially and resources being limited. As stated earlier, Darwin realized that organisms are overpopulating well beyond their means after reading Malthus’ essay. What seems to be the problem with overpopulation? A major concern is having limited resources to sustain the population. According to the text, “Malthus argued that the lack of sufficient food and water would always be a constant source of ‘misery’ and famine for humankind if our numbers continued to increase” (Jurmain et al. 32). With this in mind, Darwin produced the idea that famine would result in competition, a central theme in natural selection. Therefore, Darwin built upon the knowledge provided my Malthus.

4. I do not believe Darwin could have developed his theory of natural selection without Malthus. In Darwin's autobiography, he states “I happened to read for amusement Malthus on Population… it at once struck me that under these circumstances favourable variations would attend to be preserved, and unfavourable ones to be destroyed” (Regents of the University of California). With this realization, he was able to produce the theory of Natural selection.

5. All while Darwin was furthering his education concerning Natural selection, people were linking evolution with atheism and political subversion (Jurmain et al. 34). The growing concern with accepting these evolutionary ideas led people to believe that the church would eventually crumble. Darwin was skeptical about publishing his works, fearing that it would contradict his wife’s religious views as well as others.

Citations:

Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. Introduction to Physical Anthropology. Belmont, CA: Wadsworth Cengage Learning, 2014. Print.

Regents of the University of California. Thomas Malthus (1766-1834). 1994-2006,http://www.ucmp.berkeley.edu/history/malthus.html. Accessed 9 February 2017. 

WGBH Educational Foundation and Clear Blue Sky Productions, Inc. Darwin and Malthus. PBS, 2001, http://www.pbs.org/wgbh/evolution/library/02/5/l_025_01.html. Accessed 9 February 2017.